по-русски
StartseiteA B C D E F G H I J K L M N O ΠP Q R S T U V W X Y ZLinks

Kontakt

Zufälliges Wort

Putain de Scheiße
Putain de Scheisse!
das Buch


Hat das Wörterbuch Ihnen gefallen ? Ihre Spende hilft, die Webseite online zu halten:


Facebook


Share

C

cabane f [kaban]

Knast, Gefängnis.

Mes copains sont tous en cabane
Ou à l’armée ou à l’usine
Y se sont rangés des bécanes
Y a plus d’jeunesse — tient ça m’déprime.

(Renaud, Je suis une bande de jeunes, 1977)

cabèche f [kabɛʃ]

Kopf. Man trifft auch regional die Variante caboche.

Faut dire je suis en train de suivre une formation microsoft alors ça fait comme un clivage bizarre de lire vos trucs aériens et de me faire farcir la cabèche avec du code.

Ich mache gerade einen Microsoftlehrgang da entsteht so eine Diskrepanz wenn ich euer abgehobenen Sachen lese während ich mir die Rübe mit Code vollstopfe.

(Tatane @ liberation.fr, 10/2006)

cabot m [kabo]

Kläffer, Hund.

Ce cabot intelligent c’est ma passion
Songez que pour un chien il a fait des trucs coton
Au carrefour sa queue devient, pour traverser,
Rouge orange et verte on peut passer

(Pierre Perret, Ça va bien, ça va mal, 1962)

cadavre m [kadavʁ]

Leere Flasche („Leiche“).

Pour acheter une bouteille de bière, il faut donner trois tickets-boissons : deux pour payer, et le troisième, on le récupère lorsqu’on rapporte la bouteille une fois vide. Un système qui permet d’éviter que le sol se retrouve jonché de cadavres de bouteilles puisque les gens ont intérêt à les ramener au bar pour en racheter une autre.

(Sarah @ leblogdesarah.com, 08/2010)

cadènes pl [kadɛn]

Handschellen. Auch cadennes geschrieben, kommt über das Italienische vom Lateinischen catena (Kette).

La fille en pyjama et aux poignets trop fins pour des cadènes le plus souvent réservées aux gros bras, fait décidément beaucoup parler d’elle.

Das Mädchen im Schlafanzug und mit den zu feinen Knöcheln für die eigentlich schweren Jungs zugedachten Handschellen lässt wirklich viel von sich reden.

(Georges Moréas @ lemonde.fr, 02/2010)

cador m [kadoʁ]

Hund.

Le concept est bête comme chien : plutôt que de laisser votre cador au chenil ou en pension sans trop savoir s’il bénéficiera de tous les soins dont il a besoin, vous pourrez le déposer à l’hôtel.

(wamiz.com, 11/2009)

cafetière f [kafətjɛʁ]

Schädel, Birne.

Bing ! en plein sur la cafetière !

Wums! Voll auf die Birne!

(Tam-tam, du 23 mai 1880)

cafter v [kafte]

Verraten, petzen.

Quant à ces féroces soldats, je le dis, ce n’est pas pour cafter, mais y font rien qu’à mugir dans nos campagnes.

(Pierre Desproges)

Je pourrais bien sûr écrire mes billets du boulot (sans vouloir cafter j’en connais certaines qui le font) mais... bon ça m’arrive d’avoir du travail.

(Valérie @ blogspot.com, 04/2010)

cafteur m [kaftœʁ]

Petzer.

Nous sommes au Moyen-Âge et de drôles de petits oiseaux cafteurs n’hésitent pas à divulger les secrets de tout le village.

(iluze @ over-blog.com, 04/2011)

cage à miel f [kaʒ a mjɛl]

Ohr.

Vous en voulez de la vraie zique, du bon vieux gros son qui vous dégage les cages à miel et qui vous envoie au tapis à coup de riffs saignants et de solo incandescents ?

Wollt ihr echte Musi, mit fettem Sound, der die Ohren reinigt und dessen mörderischen Riffs und heißen Solos euch zum Boden werfen?

(Philou @ legrigriinternational.com, 06/2010)

cageot m [kaʒo]

Unattraktive Frau (eigentlich „Holzkiste“).

Ce qui est bien c’est que comme ça on a toujours tort. On est soit une cruche, soit un cageot. L’idéal qu’on devrait atteindre, c’est Lara Croft : une héroïne ultra-physique, mais glamour, qui enchaîne les aventures dans la jungle sans auréoles sous les bras et sans que ses seins ne ballotent. Elle n’existe pas ? Zut alors.

(Entrées en lice @ over-blog.com, 06/2011)

cagouinces pl [kagwɛ̃s]

Toiletten.

La petite alcôve située au-dessus de la cuvette des cagouinces a une hauteur trop réduite pour pouvoir l’utiliser pour y mettre des objets utiles ou décoratifs.

(slayer-zone @ overblog.com, 09/2009)

caguer v [kage]

Stuhlgang haben. Aus eine südfranzösischen Dialekt.

Caguer écologique sur neige ?

(Visiteur Skieur ! @ skirandonnenordique.com, 03/2011)

caillassage m [kaijasaʒ]

Bewurf mit Steinen.

La Fédération égyptienne devra s’expliquer devant la FIFA et se défendre face aux accusations qui planent dans l’affaire du caillassage du bus de l’équipe nationale algérienne où plusieurs joueurs avaient été blessés.

(L’Équipe, 04/2010)

caillasser v [kajase]

Steine werfen.

Trois nouveaux bus ont été caillassés à Tremblay-en-France (Seine-Saint-Denis) mercredi soir et dans la nuit, entraînant des dégâts matériels assez importants sur deux d’entre eux mais aucun blessé.

Drei neue Busse wurden Mittwoch am Abend und in der Nacht in Tremblay-en-France (Seine-Saint-Denis) mit Steinen beworfen. Es entstand ein größerer Sachschaden an zwei von ihnen aber keine Verletzten.

(AFP, 04/2010)

cailler v [kaje]

Frieren.

Alors, parait que ça caille à Paris ?

(Ouilloutte @ over-blog.com, 07/2011)

caillera f [kajʁa] (verlan)

Gesindel, Verlan von racaille.

Prompt à stigmatiser la génération caillera et l’esprit des cités, le philosophe des temps modernes est frappé en revanche de cécité lorsqu’il convient de s’attaquer aux puissants notamment à la classe politique.

Der Philosoph der modernen Zeit ist schnell dabei, die Kanackengeneration und den Geist der Wohnsilos zu verdammen, er ist aber blind sobald es darum geht, die Mächtigen und insbesondere die Politiker anzugreifen.

(Henry Moreigne @ lemonde.fr, 06/2010)

caillou m [kaju]

Kahler Kopf.

Certains bébés naissent sans un cheveu sur le caillou, d’autres par contre ont déjà de jolis cheveux bruns entourant leur visage.

(Éric @ babyfrance.com, 07/2011)

cainfri m [kaɛ̃fʁi] (verlan)

Schwarzafrikaner, Verlan von Africain. Man trifft auch die Kurzform cainf.

Crois pas qu’j’en tire une gloire quelconque,
Mais comprend que notre histoire c’est pas une histoire quelconque,
Cette histoire c’est la nôtre si elle ressemble à la vôtre
C’est que vous cainfri, vous êtes donc des nôtres.

(Kery James, Thug Life, 2007)

caisse f [kɛs]

Pkw (Kiste).

L’autoroute est bloquée, il y a deux voies, d’un côté une caisse de keufs, de l’autre une herse pour crever les pneus.

(rebellyon.info, 05/2010)

Lâcher une caisse: furzen.

calbard m [kalbaʁ]

Boxer Shorts (Verformung von caleçon).

C’est bien simple, moi je suis en calbard en train d’écrire ce billet (en retard, ok, on est samedi, mais bon, évidemment que non je suis pas en calbard au bureau), un joli air d’été souffle à travers les rideaux de nos fenêtres ouvertes et j’ai même pas la chipolata qui se recroqueville.

Es ist ganz einfach, ich sitze gerade in Boxershorts und schreibe diesen Beitrag (mit Verspätung, gut, heute ist Sonnabend, aber immerhin, natürlich sitze ich nicht bei der Arbeit in der Unterbuchs), ein leichter Sommerwind bläst durch die Gardinen unserer offenen Fenster und mein Schniedel ist nicht mal geschrumpft.

(Le Papa de Sigmund @ free.fr, 04/2007)

calbombe f [kalbɔ̃b]

Lampe, Kerze.

Parfois les parties se poursuivaient à la lueur des bougies, provoquant les recriminations de ceux qui voulaient dormir :
— Vous allez l’éteindre votre calbombe ?
À la fin, elle attirait les sentinelles qui gueulaient :
— Licht aus !

(Jacques Bens, Un Week-end au Touquet, 1991)

calbute m [kalbyt]

Halblange Unterhose, Boxershorts (abgeleitet von caleçon).

On peut même s’asseoir n’importe où
Sur des bouts de verre ou sur des clous
Pour déchirer le fond de son calbute
En se grattant la peau du luth.

(Mes souliers sont rouges, Quand plus rien ne va)

calcer v [kalse]

Ficken.

Le pilote devait être dans les hâtes de rentrer calcer sa bergère, car il posa son fer à souder avec dix broquilles d’avance sur la piste de Genève Cointrin.

Der Pilot musste es eilig haben, seine Schnecke zu Hause durchzubügeln, da er seinen Blechvogel zehn Minuten früher als geplant auf der Landebahn von Genf-Cointrin niedersetzte.

(San-Antonio, Meurs pas, on a du monde, 1980)

calcif m [kalsif]

Boxer Shorts (Verformung von caleçon).

— Bon mari, bon père, il n’avait qu’un petit vice, bien anodin, ma foi : il passait des photos de son calcif sur twitter.

(Gudule @ over-blog.com, 06/2011)

calebasse f [kaləbas]

Schädel, Birne.

Et puis de près on se rend compte de la pauvreté intellectuelle, de l’affligeante disette neuronale qui règne dans la calebasse qui sert de tête à cette personne. On imaginait une artiste curieuse et passionnée et on découvre une gamine capricieuse et sans vocabulaire.

(jeaneg @ les-femmes-aux-cheveux-courts.com, 05/2010)

calèche f [kalɛʃ]

Karre, Auto.

On fait comme tout le monde Frasto ; on prends ses petites papates comme tout le monde, on monte dans sa calèche comme tout le monde et on va chercher son petit Saint-Émilion Grand Cru Classé (Chateau Laroque) à la propriété comme tout le monde.

(Ellyad @ nextgaymer.com, 11/2009)

calencher v [kalɑ̃ʃe]

Abnippeln, sterben.

« Nice shot !  » commente, admiratif, le chef de patrouille. « Thanks, sir », répond modestement le massacreur. En dessous, en plus de la douzaine de civils irakiens qui viennent de calencher (dont deux personnes venues porter secours), deux employés de Reuters perdent la vie.

(tde @ typepad.com, 11/2010)

calendos m [kalɑ̃dos]

Camembert.

Mon frigo sent le calendos aux fraises. Y a des jours comme ça... un vieux calendos oublié et quelques fraises ratatinées, et voilà tout mon univers bouleversifié par des effluves nauséabondes.

Mein Kühlschrank riecht nach Camembert und Erdbeeren. Es gibt solche Tage... ein alter vergessener Camembert und ein paar ausgetrocknete Erdbeeren und schon wird mein Universum durch ekelige Düfte durcheinander gebracht.

(Ginger @ blogspot.com, 05/2005)

calfouète m [kalfwɛt]

Halblange Unterhose, Boxershorts (abgeleitet von caleçon).

Je me souviens des années de « l’extrémisme féministe » où on demandait aux filles militantes ce qu’elle nous reprochait fondamentalement — mis à part le fait d’avoir deux grotesques couilles qui se balançaient dans le calfouète — et la réponse était, bingo : Le pouvoir !

(Bertrand @ blogspot.com, 09/2010)

calotte f [kalot]

Schlag auf den Kopf.

Elle va tomber la calotte, hein !

(Anthony Kavanagh, 06/2000)

calotter v [kalote]

Auf den Kopf schlagen.

Ils ont aussi le front bas et la main prompte à calotter madame, si elle sert la bière un peu trop lentement.

(Courant Libre @ narkive.com, 10/2010)

calter (se ~) v [sə kalte]

Abhauen, verduften.

Je le paie avec des boutons de culotte — j’ai le temps de me calter avant qu’il ait compté ma fausse monnaie.

Ich bezahle mit Hosenknöpfen und habe Zeit zu verduften, bevor er mein Falschgeld nachzählt.

(Didier Siguret @ blogspot.com, 12/2006)

cambrousse f [kɑ̃bʁus]

Pampa, ländliche Gegend. Im 19. Jahrhundert sagte man auch cambrouse.

Aujourd’hui, je suis tombé en panne d’essence en pleine cambrousse, obligé de faire du stop pour rentrer chez moi.

Heute ist mir mitten in der Walachei das Benzin ausgegangen, ich musste per Anhalter nach Hause.

(VDM, 01/2008)

came f [kam]

Stoff, Drogen.

Informé, il rapplique dare-dare sur les lieux et en un temps-éclair, il livre la came et empoche son argent déjà réuni.

(Abdoulaye Diédhiou @ popxibaar.com, 04/2011)

camé f [kame]

Junkie, Kiffer.

Je suis désolé mais il n’y a pas de différence entre Delarue, et les drogués aux cracks de stalingrad ou de saint denis. Un camé est un camé, point.

Es tut mir leid aber es gibt keinen Unterschied zwischen Delarue und den Crack-Abhängigen der Boulevards Stalingrad und Saint-Denis. Ein Fixer ist ein Fixer, basta.

(jd24 @ jeanmarcmorandini.com, 10/2010)

camelote f [kaməlɔt]

Minderwertige Ware.

85% des nouveaux remèdes seraient de la camelote à risque.

(Eva @ over-blog.com, 08/2010)

camer (se ~) v [sə kame]

Drogen nehmen.

Ces pseudo-défenseurs de la morale ont ainsi fustigé sur tous les médias le principe du dépistage par les parents, au nom de la liberté individuelle des jeunes. Mais quelle liberté défendent-ils ? Celle de pouvoir se camer à 15 ans ? C’est ahurissant, mais c’est pourtant leur combat !

(Carl @ depistage-drogue.com, 05/2010)

camp (foutre le ~) v [futʁ lə kɑ̃]

Abhauen, verduften.

Trop c’est trop ! Bouteflika doit dégager et le régime doit foutre le camp !

Jetzt reicht’s! Bouteflika soll verduften und sein Regime soll abhauen!

(lamia hammad @ algerie-news.com, 04/2011)

camphre m [kɑ̃fʁ]

Schnaps.

Aux buveurs émérites et à ceux qui ont depuis bien des années laissé leur raison au fond d’un poisson de camphre.

(Alexandre Privat d’Anglemont)

camphré Adj [kɑ̃fʁe]

Hochprozentig, alkoholisiert.

Dis donc, avec ton gosier camphré, tu fais bien tes embarras.

(Catéch. Poissard, 1844)

camphrer (se ~) v [sə kɑ̃fʁe]

Schnaps trinken.

Demain, à cette heure là, je serais au concert de Nine Inch Nails, à Paris, je vais me camphrer la ruche avant de rentrer !

(ann13 @ doctissimo.fr, 07/2009)

canard m [kanaʁ]

Zeitung („Ente“).

Aujourd’hui j’ai acheté Libé — ce quotidien à 40 centimes plus cher qu’un quotidien régional n’en donne pas pour son argent. Quoique, aujourd’hui la une de ce canard m’a interpellé.

Heute habe ich Libération gekauft, diese Tageszeitung, die 40 Cents teuerer ist als eine Regionalzeitung, ist nicht ihr Geld wert. Obwohl mich heute die Titelseite dieses Käseblatts angesprochen hat.

(Jean Georges @ over-blog.com, 09/2010)

canarder v [kanaʁde]

Beschießen, unter Dauerfeuer nehmen.

Puis-je canarder une colombe avec mon fusil parce qu’elle défèque sur moi et ma bagnole ?

(Prof Nico en Rilévi @ yahoo.com, 11/2008)

canasson m [kanasɔ̃]

Pferd, Ross.

Tu es souvent bidard, toi, dit Petit-Pouce à son copain. Je l’ai vu gagner plusieurs fois, ajouta-t-il ... dans des cas où il n’avait aucune chance, avec des canassons impossibles.

(Raymond Queneau, Pierrot mon ami, 1942)

caner v [kane]

Abnippeln, sterben.

Monsieur Fernand : Bon alors ? Qu’est ce qui se passe Louis ?
Louis : Je suis revenu pour caner ici et pour me faire enterrer à Pantin avec mes viocs.

Monsieur Fernand: Also? Was ist denn los, Louis?
Louis: Ich bin zurückgekommen um den Löffel abzugeben und mich in Pantin neben meinen Alten begraben zu lassen.

(A. Simonin et G. Lautner, Les Tontons flingueurs, 1963)

canne f [kan]

Bein.

Avoir de bons appuis permet d’abord de pas tomber comme une merde quand on nous rentre dedans, tenir sur ses cannes et pouvoir mieux bloquer au rebond ensuite.

(SaleRoux @ , 12/2009)

canné Adj [kane]

Tod, verstorben.

Si vous voulez mon opinion, je ne pensais plus revoir cette pépée, jamais ! Quelque chose m’avertissait qu’elle était cannée.

Wenn ihr meine Meinung wollt, ich dachte, dass ich diese Biene nie mehr wiedersehen würde! Irgendetwas sagte mir, daß sie abgenippelt war.

(San-Antonio, J’ai bien l’honneur de vous buter, 1955)

canner v [kane]

Sterben.

Les gens se sont demandé longtemps pourquoi le Napo se carrait la paluche dans le gilet. Je vais vous donner une explication rationnelle. Vous savez qu’il est canné d’un cancer à l’estomac.

(San-Antonio, San-Antonio met le paquet, 1959)

canon Adv und m [kanɔ̃]

1. Schuss, Schluck, Glass (Volumeneinheit);

Les canons que l’on traîne à la guerre ne valent pas ceux du marchand de vin.

(Brandin, Chansons, 1826)

2. Schön, geil; 3. Hübsches Mädchen.

caoua m [kawa]

Kaffee, siehe kawa.

Démarrage difficile ce matin. Un petit caoua et ça repart !

(Aline @ identi.ca, 09/2009)

capote f [kapɔt]

Kondom. Wird auch capote anglaise genannt („englischer Kapuzenmantel“).

Pourquoi est-il si agréable de baiser sans capote ? Parce qu’on prend les deux risques principaux : donner la vie et attraper la mort.

Warum ist es so angenehm ohne Pariser zu ficken? Weil man beide wichtigsten Risiken eingeht: Das Leben geben und den Tod einfangen.

(F. Beigbeder)

capter v [kapte]

Raffen, kapieren.

J’ai rien capté... C’est dur dur la modalité des fenêtres...

(Mighty Mike @ microsoft.public.fr.fox, 06/2004)

carabiné Adj [kaʁabine]

Heftig, doll.

Comment gérez vous la nuit une gastro carabinée quand les toilettes sont à côté de la chambre de vos hôtes ?

(question-info-sante.com, 04/2010)

carante f [kaʁɑ̃t]

Tisch.

À part les trognes des gonziers, qui sont des poteaux, tout le reste est de la récup d’internet. Sauf la carante et les chaises, c’est ceux d’chez moi.

(lefanstouf @ fousdanim.org, 04/2007)

carapater v [kaʁapate]

Abhauen.

c’est bizarre, j’en vois déjà qui deviennent blèmes et qui ont envie de se carapater... Non, non restez !

(Christelle Veyssière @ live.com, 11/2006)

carbure m [kaʁbyʁ]

Knete, Geld.

Tu vas penser que je balance le blé par les fenêtres ; à cela je t’objecterai qu’il s’agit de mon carbure personnel, gagné avec mes sublimes polars et que j’ai le droit de le dépenser à ma convenance.

Du wirst denken, daß ich meine Knete aus dem Fenster werfe; dazu entgegne ich dir dann, daß es mein Kies ist, den ich mit meinen wunderbaren Krimis verdient habe, und daß ich ihn wie ich will ausgeben kann.

(San-Antonio, Al Capote, 1992)

carlouche m [kaʁluʃ] (cités)

Neger, abwertende Bezeichnung aus dem gleichbedeutigend Arabischen kaḥluš.

Tous à se gargariser d’une France Black blanc beur qui n’aura existé que le temps de vos fantasmes, et continue depuis de laisser sur le côté de la route les fils de rolotos, rebeus, carlouches, manouches.

(Hervé Resse @ typepad.com, 06/2005)

carme m [kaʁm]

Geld (veraltert).

Nib de carme, pas d’argent.

(Lucien Rigaud, 1888)

carmer v [kaʁme]

Bezahlen.

D’accord mais comment carmer les factures en souffrance ?

Gut, aber wie soll man die Knete für offene Rechnungen abdrücken?

(rezonor @ hns-info.net, 10/2009)

caroube f [kaʁub]

Schlüssel.

Je fouille et je trouve que la carouble ou la caroube est la fausse clé en argot de l’italien carruba clé, le caroubleur ou le caroubeur est le cambrioleur en argot, et qu’est-ce que le marquis de Carabas sinon celui qui se livre à une sorte de cambriole ? La clé serait fausse depuis le départ !

(dito @ fr.lettres.langue.francaise, 07/2004)

carouble m [kaʁubl]

Schlüssel, Dietrich.

Vrai, c’est épatant qu’elle ne t’ait pas bouclé et qu’elle n’ait pas le carouble en fouille !

(Jean Lorrain, La maison Philibert, 1904)

carreau m [kaʁo]

Auge.

Il me fixe dans les carreaux. Tiens, il est comme la Joconde : il ne cille pas.

Er starrt mir in die Augen. So, er ist wie Mona Lisa: Er blinzelt nicht.

(San-Antonio, Al Capote, 1992)

carrée f [kaʁe]

Zimmer.

Lorsque l’on est miro,
On se planque dans sa carrée.

(Le vacher et le garde-chasse, Fables de La Fontaine en argot)

Carrouf m [kaʁuf]

Die Supermärkte der Gruppe Carrefour.

Carrouf fait confiance à Domenech. Coup de génie publicitaire de Carrefour et Saturn. Ils rembourseront intégralement l’achat des télés et des ordis en cas de victoire de la bande à Raymond au Mondial en Af’sud.

(c’est juste histoire de dire @ blogspot, 05/2010)

casba f [kasba]

Wohnung, Absteige. Aus dem Arabischen (قصبة qaṣba, Festung).

Y a pas un astibloch
Qui viendrait y faire sa casbah.

(Pierre Perret, C’est bon pour la santé)

casquer v [kaske]

Bezahlen.

Pourquoi casquer pour écouter de la musique ?

Weshalb blechen um Musik zu hören?

(topblabla.com, 07/2010)

casse m [kas]

Einbruch.

Faire un casse dans un magasin, possible ou pas...

(jeuxvideo.fr, 01/2008)

casse-couilles m [kas.kuj]

Nervensäge.

Pourquoi nos casse couilles à nous ne jouent pas comme Balotelli ?

(edika @ fr.rec.sport.football, 06/2012)

casse-dalle m [kas-dal]

Sandwich, eine Kleinigkeit um den Hunger zu stillen.

Après un casse-dalle avalé dans un fast food rétro à la déco « Années 60 », nous filons en courant sous une pluie toujours battante vers le Georgia World Congress Center (le GWCC) à un bloc de là, non loin de Centennial Park.

(Jean Laengy @ unblog.fr, 10/2010)

casse-gueule Adj [kas-gøl]

Gefährlich, riskant.

Une aventure vraiment casse-gueule. Un expert russe exprime sa perplexité face à l’intervention des Occidentaux en Libye. Pour lui, l’opération est confuse, mal préparée et sans objectif clair.

(maghreby.com, 04/2011)

casser v [kase]

Einbrechen.

Ils forment avec lui le trio classique de malfaiteurs qui, lorsqu’ils ne « cassent » pas, attirent les « pigeons » au jeu et les plument à l’aide de faux dés.

(F. Carco, Nostalgie de Paris, 1941)

casser (se ~) v [sə kase]

Abhauen, verduften.

Casse-toi, pauvre con !

Verzieh Dich, Du Arschloch!

(Nicolas Sarkozy, 23/02/2008)

casser la croûte, la graine v [kase la kʁut, la gʁɛn]

Fressen, futtern.

Je pense que la comparaison que tu fais avec la route est un peu hâtive... En effet, s’arréter sur l’autoroute au milieu de la file la plus à droite pour casser la croûte serait effectivement plus incongru...

(Jean-Mi @ fr.rec.bateaux, 06/2004)

casseur m [kasœʁ]

Randalierer.

Arrêtons les fantasmes ! L’infiltration, ça se fait depuis toujours dans le but d’interpeller les casseurs et de sécuriser les manifs. S’il y avait des provocations, ça se verrait tout de suite, surtout avec les vidéos qui circulent de nos jours.

(Nicolas Ballet @ leprogres.fr, 10/2010)

cassos (jouer ~) v [ʒue kasos]

Abhauen, verduften.

Quand j’aurai fait le coup, il faudra jouer cassos en vitesse ! Tu feras comment avec ta guibolle ?

(ortiti @ kazeo.com, 05/2008)

castagne f [kastaɲ]

Schlägerei.

Le 1er Mai, jour de castagne traditionnel à Zurich.

Der erste Mai, Tag traditionneller tatkräftigen Außeinandersetzungen in Zürich.

(Camille Kraft @ lematin.ch, 05/2010)

castagner (se ~) v [sə kastaɲe]

Sich prügeln.

Lorsqu’elle ne chante pas et qu’elle ne se fait pas tatouer, elle se castagne avec ses petits amis.

Wenn sie nicht singt und sich nicht tätowieren lässt prügelt sie sich mit ihren Freunden.

(Daniel Lesueur @ suite101.fr, 02/2011)

cavaler v [kavale]

Laufen, abhauen.

Une fois les béquilles tombées et la douleur envolée, je n’avais pourtant envie que d’une seule chose : recommencer à cavaler... et sans chaussures ! Courir sur tapis me faisant l’effet de cavaler dans une roue façon hamster, je me suis évidemment tournée vers les Vibram !

(Aurélie @ wanarun.net, 06/2010)

cave m [kav]

Einfaltspinsel, Person die nicht zur Halbwelt gehört (veraltert).

Il y aura toujours un cave qui ira plus loin afin de repousser les limites. Ce cave peut être notre voisin, notre cousin, notre ami, ou juste le gars au coin de la rue. Des caves il y en aura toujours.

(Pierrot lalune @ aaaatglobal, 12/2010)

cécolle Pronomen [sekol]

Er.

La descente la plus vertigineuse de la cité, c’était cécolle qui la possédait.

Das ärgste Trinkvermögen der Siedlung, das hatte seine Fresse.

(blogspot.com, 03/2008)

céfran m [sefʁɑ̃] (verlan)

Franzose, Verlan von Français.

Quoi que tu fasses, le melting pot français est ainsi fait :
Renoi, Céfran, Rabza, Spanish, Tos,
Portuguesh, Kung Fu, Macaroni.

(11min30 Contre Les Lois Racistes)

cégnace Pronomen [seɲas]

Er.

Il rechigne un tantinet avant d’obtempérer. En même temps, je l’comprends. Ce sale climat est inconnu pour cégnace.

(Anthony Michel, Le SphynX ToniTruand, 2006)

cézigue Pronomen [sezig]

Er.

On se doute bien que cézigue, issu d’une famille d’industriels de Tourcoing, fils de l’ancien directeur d’Indosuez Scandinavie n’a jamais eu à se préoccuper de problème d’augmentation, papa était là et lui avec ses retraites d’élu il en fera de même pour sa descendance, alors tous les autres il peut les méprise ... grrr !

(ppcaillou @ over-blog.com, 08/2011)

chabannais m [ʃabanɛ]

Lärm, Radau.

Tout le monde, y compris N., savait qu’il y aurait le soir du chabannais.

Alle, auch N., wussten, daß es abends Radau geben würde.

(Figaro, du 14 juillet 1880)

chaffrave m [ʃafʁave] (cités)

Arbeit, aus dem Romani chafrè.

Les crédits que tu empoches par ton chaffrave de smicard te filent entre les pognes pour aller engrosser rachitiquement ton compte.

(Saltykov @ cowblog.fr, 08/2010)

chagatte f [ʃagat]

Fotze.

Tu as l’esprit comme la chagatte : tourné vers la braguette, ma pauvre mignonne.

Dein Geist ist wie deine Fotze: auf den Hosenschlitz gerichtet, mein armes Süßes.

(San-Antonio, Concerto pour porte-jaretelles, 1976)

chaglate f [ʃaglat]

Fotze. Auch chaglatte geschrieben.

Elle a la chaglate en sang ou quoi ta pouf ?

Hat deine Schlampe eine blutige Muschi oder was?

(tarek @ centerblog.net, 05/2010)

chaille (à ~) Redewendung [a ʃaj]

Weit weg, am Arsch der Welt.

On arrive à se garer sur le parking de l’hopital, à chaille mais bon !

Wir schaffen es, auf dem Krankenhausparkplatz zu parken, JWD aber was soll’s!

(Charly @ parents.fr, 09/2011)

chailles pl [ʃaj]

Zähne.

La Jeanne elle bouffait trop de sucreries, matin et soir, du berlingot vanillé à la fraise tagada en passant par le carambar aux olives, toujours à mâchouiller une de ces saloperies qui vous pourrissent les chailles avant l’heure, si bien qu’à 13 ou 14 piges, on ne sait pas exactement, elle fréquenta plus souvent le dentiste que l’école.

(meyronein @ blog.fr, 02/2009)

chambrer v [ʃɑ̃bʁe]

1. Veräppeln, verarschen; 2. Lügen.

Non, je ne deviens pas louftingue, je ne vous chambre pas, je chique pas à l’auteur de science-fiction, je ne gambade pas dans la quatrième dimension, je ne parodie pas le cher regretté Marcel Aymé, je ne me paie pas vos hures, malgré les bonnes raisons que j’aurais... Je ne fais qu’exprimer une vérité...

(San-Antonio, Ma langue au Chah, 1969)

chaparder v [ʃapaʁde]

Klauen, stibizen.

À 12 ans, j’ai fumé ma première cigarette, à 13 ans commencé à chaparder dans les magasins. Ensuite, j’ai volé un cyclomoteur et ai subi une première arrestation.

Mit 12 habe ich meine erste Zigarette geraucht, mit 13 begann ich in den Geschäften zu klauen. Danach habe ich ein Moped gestohlen und wurde zum ersten Mal verhaftet.

(over-blog.com, 05/2010)

char m [ʃaʁ]

Auto, Karre.

Disons que le gars de Montréal-Est dit « char » quand il parle de sa vieille Toyota Corrola rouillée et que le gars... euh... le monsieur d’Outremont dit « voiture » lorsqu’il parle de sa Mercedes 300 coupé.

(fredak @ projetbabel.org, 04/2006)

charclo m [ʃaʁklo] (verlan)

Penner, Verlan von clochard.

C’est un gentil bonhomme qui vous aide à mettre des phrases bout à bout, pour en faire une belle histoire. Sous ses airs de charclo, c’est qu’il est très intelligent...

Es ist ein lieber Kerl, der einem hilft Sätze zusammenzustellen, um aus ihnen eine schöne Geschichte zu machen. Hinter seinem Penneräußerem ist er sehr intelligent...

(Sylvie @ canalblog.com, 05/2007)

chargé Adj [ʃaʁʒe]

Breit, auf Drogen.

En fait la première fois que j’ai goûté l’héroïne c’était en même temps que la cocaïne. C’était un speed-ball qu’on m’avait offert. Là c’était à une… à une fête où eh… je crois que c’était la première fois qu’on consommait autant, que ce soit donc en ecsta ou en trip eh… j’avais dû aussi prendre un… un ballon ce jour-là. Donc ce jour-là, on avait déjà bien chargé.

(Nicole, citée dans Les nouveaux usages de l’héroïne, 2002)

charres pl [ʃaʁ]

Lüge.

Car nos chers gouvernants, au lieu d’encadrer la spéculation à risque, ont préféré nous raconter des charres comme quoi, ils agissaient ou avaient l’intention d’agir pour empêcher la finance internationale de batifoler dans nos plates bandes.

(René Guiart @ blogspot.com, 05/2010)

charrette f [ʃaʁɛt]

Massenentlassung.

Les charrettes suivent les saisons à la Comédie-Française, et les acteurs qui, hier encore, faisaient régner l’ordre et la terreur sont aujourd’hui sur le pavé de la place Colette, tout ahuris de leur triste sort.

(Renaud Meyer @ wordpress.com, 12/2009)

charrier v [ʃaʁje]

Verarschen, veräppeln.

On n’aime pas se faire charrier...

Wir lassen uns nicht gerne verarschen...

(Pifpafpouf @ caledosphere.com, 04/2010)

châsse m [ʃɑs]

Auge.

Ça vous crève les châsses, qu’il en tient pour Myrille.

(Jean Lorrain, La maison Philibert, 1904)

châtaigne f [ʃɑtɛɲ]

Faustschlag.

Dans ce jeu, le hasard est omniprésent, vous pouvez avoir une montagne de muscle orque qui colle des châtaignes à tout ce qui passe et puis il peut très bien se faire tabasser par un Halfing (Hobbit) au tour d’après !

(Dminet0 @ lets-play.fr, 07/2011)

château-la-pompe m [ʃɑto-la-pɔ̃p]

Leitungswasser.

La soirée fût fort sage, après une plâtrée de pâtes et un dessert des plus simples, le tout accompagné de Château la Pompe, nous rentrâmes nous coucher sagement.

(Fafa @ blogspot.com, 09/2010)

chatte f [ʃat]

Weibliche Geschlechtsteile (wörtlich „Katze“).
Bouffer la chatte: Sexuelle Stimulation weiblicher Geschlechtsteile mit Zunge und Lippen.

Je lui suppose une petite chatte de tirelire peu apte à mon braque occidental.

Ich vermute bei ihr einen kleinen Schlitz, wie eine Spardose, wenig geeignet für meinen westlichen Schwanz.

(San-Antonio, Princesse Patte-en-l’air, 1990)

chaud Adj [ʃo]

1. Schwer, kompliziert, gefährlich; 2. Geil, schlüpfrig.

Je la désire, elle m’enflamme parce qu’elle est chaude !

(TheMajesty @ asslema.com, 01/2008)

chaudasse f [ʃodas]

Geile Schlampe, Flittchen.

Vous avez tous remarqué que la plupart des nouvelles actrices pornos sont hongroises ? pourquoi ? parce que c’est bien connu, en Hongrie les deux métiers qui font rêver les jeunes c’est président de la république française et chaudasse.

Habt ihr alle bemerkt, dass die meisten neuen Pornodarstellerinnen aus Ungarn stammen? Wieso? Weil es ja allseits bekannt ist, dass die zwei Berufe, von denen die Jugend in Ungarn träumt, Präsident der französischen Republik und Schlampe sind.

(queutard @ blogspot.com, 02/2005)

chbeb m [ʃbɛb] (cités)

Passiver Homosexueller. Lehnwort aus dem algerischen arabischen شباب (šbāb — hübsch).

Désolé de te décevoir mais je suis bien hétéro, cherches en un autre, sale chbeb, et si t’en trouves pas bah... il reste ton frére.

(YouYouKid77 @ booska-p.com, 04/2009)

chelou Adj [ʃəlu] (verlan)

Merkwürdig, komisch, auffällig. Verlan von louche.

Donc on récapitule, on n’essaie pas du chelou à la Maison du Sushi, on ne prend que du classique.

Also kurz und gut, im Haus des Sushis probiert man nichts komisches, man bestellt nur klassisches.

(Math @ blogspot.com, 10/2010)

chetard m [ʃətaʁ]

Knast, Gefängnis.

C’est lui d’ailleurs qui m’a fait découvrir Boudard que je dévore depuis. J’adore Boudard, le Céline des rues qui s’est fait la fac au chetard (prison) !

(Philippe Tristan @ pbtristan.fr, 02/2010)

chetron f [ʃətʁɔ̃] (verlan)

Fresse, Verlan von tronche.

Faut qu’il arrête de me prendre pour un blaireau lui ! Parce que j’vais lui latter la chetron !

Der soll mal aufhören mich für einen Armleuchter zun halten! Sonst polier’ ich ihm die Fresse!

(Hervé Palud, Les frères pétard, 1986)

chiadé Adj [ʃiade]

Dufte, sauber, geil.

Chiadé ! C’est officiel, Sony l’a confirmé, la belle et culte Sade a prévu de sortir un nouvel album pour l’automne prochain.

(Rip Laimbeer @ blogspot.com, 05/2009)

chialer v [ʃiale]

Weinen.

Ah, si, puis alors, question émotions, moi, c’est simple, j’ai chialé pendant une heure... Ah oui, un beau mariage, hein !

Ach ja, also, in Sachen Gefühle, ich habe einfach eine Stunde lang geflennt... Ja, eine schöne Hochzeit, echt!

(Jean-Marie Bigard, La photo de mariage)

chiant Adj [ʃiɑ̃]

Lästig, öde, ätzend.

Aujourd’hui, j’ai pour travail de mettre des prospectus sous les essuie-glaces des voitures. Ce que je fais sur le parking d’un grand supermarché. Qu’y a-t-il de plus chiant que mettre mille prospectus ? Les enlever avec l’agent de sécurité vraiment pas commode qui vous regarde.

(VDM, 08/2009)

chiard m [ʃiaʁ]

Kind, „Scheißerchen“. Auch chiare geschrieben.

— Quand on a pas de bonnes pour garder ses chiards, eh bien on en fait pas.

— Wenn man kein Kindermädchen für seine Hosenscheißer hat, dann kriegt man halt keine.

(Michel Audiard, Mélodie en sous-sol, 1963)

Quand j’étais chiare, on jouait à la bataille, m’man et moi, les soirs d’hiver et les jours de convalescence.

Als ich noch ein kleiner Hosenscheißer war spielten wir mit Mami an langen Winterabenden oder wenn ich krank war Karten.

(San-Antonio, Ça mange pas de pain, 1970)

chiasse f [ʃias]

Durchfall.

Je suis allé chez les Chinois
Putain la vache ils sont nombreux
Je me suis gavé de soja
J’ai eu la chiasse c’est monstrueux.

(Marcel et son orchestre, Depuis le temps)

chiatique Adj [ʃiatik]

Ätzend, lästig.

Merci à toute l’équipe d’Axome pour leur légendaire patience (surtout avec un client aussi chiatique que moi), et surtout merci à notre fabricant Broussaud Textiles et à toute son équipe, de s’être autant impliqué dans la fabrication de cette nouvelle gamme.

Danke der ganzen Mannschaft von Axome für ihre märchenhafte Geduld (besonders bei einem so nervigen Kunden wie mich), und besonders danke unserem Hersteller Broussaud Textiles und seiner gesamten Mannschaft, die sich so stark in die Herstellung der neuen Kollektion eingebracht hat.

(Patrice @ archiduchesse.com, 01/2010)

chiave f [ʃjav]

Schlüssel.

Je lourde. Cric, crac. Mets la chiave dans ma poche.

(San-Antonio, J’ai essayé, on peut, 1973)

chibre m [ʃibʁ]

Penis.

Ah ce qu’il est beau mon chibre
Quand il est à l’air libre.

Ach was ist mein Schwanz schön,
Wenn er an der frischen Luft ist.

(Pierre Perret, Mon chibre, 1995)

chibrer v [ʃibʁe]

Ficken, vögeln.

La sublime Sophia se fait chibrer pour vous !

Die umwerfende Sophia lässt sich für euch vögeln!

(Spam, 06/2011)

chichemanes pl [ʃiʃəman]

Klo, Toilette.

On a filé de la naphtaloche entre les couvrantes et du décapant parfumé dans la lunette des chichemanes.

(San-Antonio, Ça mange pas de pain, 1970)

chiches pl [ʃiʃ]

Klo, Toilette.

J’étais aux chiches quand la gonzesse à sonné.

Ich war auf dem Lokus als die Schnecke klingelte.

(San-Antonio, Bons baisers où tu sais, 1987)

chichon m [ʃiʃɔ̃]

Haschisch.

L’opposition chichon/pinard argumentée par les défenseurs de l’herbe-qui-fait-rire est illusoire : les p’tites feuilles ont la même tendance à faire des dégâts discrets par en-dedans.

(Aigle bavard @ fr.rec.moto, 05/2004)

chier v [ʃje]

Scheißen, kacken.

Fille de roi, dans ta beauté si fière,
Tu dois chier, c’est Dieu qui l’a voulu.
Ton cul royal, tel un cul prolétaire,
Tous les matins doit payer son tribut...

(La pompe à merde, chanson)

Faire chier: nerven, auf den Geist gehen.

Je fais chier tout le monde.

(Louis-Ferdinand Céline, Guignol’s band, 1944)

Avec les femmes, il y a trois étapes : tu les fais rire, tu les fais jouir, tu les fais chier. Et il ne faut jamais passer à la troisième étape avant d’avoir franchi les deux premières.

(Patrick Timsit)

Se faire chier : sich langweilen. « Je me fais chier comme un rat mort » : ich langweile mich zu Tode.
Envoyer chier: vulgärer Ausdruck des Ärgers, lmaa.

Mon colocataire a lancé un « va chier » sonore, puis est revenu s’asseoir.

(Patrick Bouvier, Des nouvelles de la ville, 2002)

chieur m [ʃjœʁ]

Nervensäge, Arschgeige.

Est-ce que j’aimerais vivre avec un chieur qui refuse systématiquement mes choix de films à aller voir au ciné ? Non. En fait, c’est pour ça que je suis toujours célibataire : je suis trop difficile.

(uncelibataugoutdenutella.com, 04/2011)

chignole f [ʃiɲol]

Karre, Auto.

Enfin, bon Dieu, quand un homme masqué crève les boudins de votre chignole et vous menace d’un revolver, il y a de quoi vous commotionner et commotionner votre entourage, non ?

Also, um Gottes Willen, wenn ein maskierter Mann die Reifen eures Auto zersticht und sie mit einem Revolver bedroht, das reicht doch um sie und ihre Umgebung zu erschüttern, oder?

(San-Antonio, San-Antonio chez les Mac, 1961)

chignon m [ʃiɲɔ̃]

Birne, Kopf.

— Vous me la placez dans le chignon ? interrogé-je en désignant son pétard d’un hochement de tête par-dessus mon épaule.

(San-Antonio, Vas-y Béru !, 1965)

chinago m [ʃinago]

Chinese.

Celui-ci considère qu’il n’est pas responsable de cette méprise, et puisque après tout, « il ne s’agit que d’un Chinago », il préfère appliquer l’ordre qui lui a été donné et abat la guillotine.

(Mémoire d’immigrés et malemort : Controverses autour du passé coolie chez les Chinois de Tahiti, Anne-Christine Trémon, Ecole des Hautes Etudes en Sciences Sociales (EHESS))

chinetoc m [ʃintok]

Chinese.

Un chinois enlevé ? Mais que fait ce chinetoc à Amdjeress ? Selon les mauvaises langues, Deby a octroyé de manière tout à fait illégale et clandestine un permis des recherches des métaux précieux à une société chinoise.

(Beremadji Félix @ tchadonline.com, 09/2010)

chinetoque m [ʃintok]

Chinese. Auch als Adjektiv (Chinesich) gebräuchlich.

J’ai fait le pari loufoque que je reviendrai là-bas
Chanter le zizi en chinetoque y-z-en seront baba...

(Pierre Perret, Comment c’est la Chine, 1983)

chiottes pl [ʃjɔt]

Scheißhaus, Toiletten.

Aujourd’hui, plus de net. J’ai remarqué que le seul endroit où je captais le wifi non protégé du voisin, c’était quand on était assis sur les chiottes, le pc sur les genoux.

Heute habe ich kein Internet mehr. Ich habe bemerkt, dass der einzige Ort, an dem ich das ungeschützte WiFi meines Nachbars empfangen kann ist wenn man auf dem Locus sitzt, mit dem Rechner auf den Knien.

(VDM, 03/2008)

chiper v [ʃipe]

Klauen, stehlen.

Vous commettez des vols dits « sans conséquence » et prenez un certain plaisir à chiper les objets de faible valeur qui vous tombent sous la main (couverts au restaurant, peignoirs à l’hôtel, magazines chez le coiffeur, etc).

(da audrey @ doctissimo.fr, 04/2010)

chleu m [ʃlø]

Deutscher. Alternative Schreibweise: Chleuh. Ursprünglich der Name eines berberischen Bergstammes aus Marokko, auch Taschelhit genannt.

De tous les côtés, la bataille s’engage. Surtout, ne croyez pas que les Chleuhs restent à ne rien faire...

Von allen Seiten beginnt die Schlacht. Und glaubt ja nicht, das der Piefke tatenlos zuschaut...

(San-Antonio, Laissez tomber la fille, 1950)

chlinguer v [ʃlɛ̃ge]

Stinken.

Comment faire pour qu’une paire de chaussure arrête de chlinguer ?

(chaussuresfr.org, 04/2011)

chnouf f [ʃnuf]

Drogen, Rauschgift. S. schnouff.

De la chnouf au 4e Groupe logistique du Commissariat de l’armée de Terre.

Heroin in der 4. Logistikgruppe des Heereskommissariats.

(opex360.com, 06/2010)

chochotte f [ʃoʃɔt]

Schwuchtel.

Là, j’voudrais ouvrir une parenthèse, mes chers élèves, su’ la manière, pour une jeune fille d’déballer l’guiseau d’un jules. Pas l’prendre à la chochotte, comme si s’agirerait d’un p’tit four chez la comtesse.

(San-Antonio, Valsez, poufiasses, 1989)

chocottes Adj [ʃokɔt]

In der Redewendung avoir les chocottes: Angst haben.

Non, non, jamais les chocottes
De te choper la mort ou bien un moufflet

(Elmer Food Beat, Le plastique c’est fantastique, 1991)

chômedu m [ʃomədy]

Arbeitslosigkeit, Stütze.

Là je suis au chômedu, ce n’est pas bien grave, mais quand je travaillais, il m’est arrivé d’aller bosser 8 heures debout en ayant dormi deux heures et parfois moins. Dur, dur.

Jetzt bin ich arbeitslos, da ist es nicht schlimm, aber als ich noch arbeitete war ich manchmal acht Stunden im Stehen arbeiten obwohl ich nur zwei oder weniger Stunden geschlafen hatte. Ganz schön hart.

(Calliope2 @ psychologies.com, 03/2007)

choper v [ʃope]

Erwischen, fangen.

Avant qu’il ait pu dire un mot
J’ai chopé l’mec par le paletot
Et j’ui ai dit :
Toi tu m’fous les glandes
Pis t’as rien à foutre dans mon monde
Arrache toi d’là t’es pas d’ma bande
Casse toi tu pues
Et marche à l’ombre.

(Renaud, Marche à l’ombre, 1980)

se faire choper: erwischt werden.

chopine f [ʃopin]

Schwanz, Penis.

M. Félix ! Tiens, un revenant ! Des années que je suis sans nouvelles de l’illustre professeur, fameux par son sexe dont le calibre ridiculise celui de Bérurier ! Le cas anatomique du siècle ! Une chopine d’un demi-mètre de long sur huit centimètres de diamètre !

(San-Antonio, Baisse la pression, tu mes les gonfles !, 1988)

choucard Adj [ʃukaʁ]

Süß, nett, anmutend. Weiblich: choucarde. Kommt aus dem Romani (shukár — schön).

Le clip est un summum de moyens techniques, de costumes, et de scénario : la chanteuse était choucarde et exécutait une gentille chorégraphie, ça remplissait le cahier des charges à ravir à l’époque...

(fridirock @ blogspot.com, 05/2010)

choucroute (tête ou mangeur de ~) f [tɛt u mɑ̃ʒøʁ də ʃukʁut]

Deutscher.

Vous oubliez dans votre emportement que Dany le rouge est qui plus est un mangeur de choucroute de la pire espèce.

Sie vergessen in ihrem Elan, daß der rote Dany zusätzlich ein Piefke der schlimmsten Art ist.

(jjrousseau @ livejournal.com, 03/2010)

chouf, chou-fleur m [ʃuf, ʃu-flœʁ]

Krebs (Krankheit).

— Fais vite, vu que j’ai rendez-vous chez le radiologue pour mes clichés de l’estomac. Figure-toi que lorsque je mange des crudités, j’ai comme des brûlures...
— Et t’as peur d’un chou-fleur ?
— On pense tout de suite à ça, avoue la Vieillasse.

(San-Antonio, L’histoire de France vue par San-Antonio, 1964)

choufer v [ʃufe] (cités)

Gucken, glotzen, aus dem Arabischen (شُفْ šuf!, guck!).

Je pourrais continuer comme ça pendant des heures, à choufer mes voisins et à m’extasier sur le détail qui me fait les aimer plus.

(kristobalone @ wordpress.com, 05/2008)

chougner v [ʃuɲe]

Weinen, flennen.

La détestable Belgique Francophone nous enseigne la même chose, elle qui n’en finit pas de chougner sur ces méchants Flamands qui non contents de les avoir oppressés, veulent aussi ne plus les voir et ne plus entendre chougner.

(XP @ ilikeyourstyle.net, 07/2010)

chouïa m [ʃuja]

Wenig, eine sehr kleine Menge. Aus dem Arabischen (شوية šuwayya, Kleinigkeit).

Je crois que je suis un chouïa maso...

Mir scheint, daß ich ein wenig masochistisch bin...

(cybermaman.net, 02/2010)

chouiner v [ʃwine]

Jammern.

J’ai un souci avec Nathanaël ! Il arrête pas de chouiner tout le temps pour rien !

(Soangel81 @ bebe.ch, 04/2010)

choune f [ʃun]

Fotze, Lehnwort aus einer Berbersprache.

Je suis guidé par ma teub
Ici ça pue trop la choune.
Donc ramène tes fesses
Et déhanche-toi ma belle.

(TTC, Dans le club)

chouraver v [ʃuʁave]

Stehlen, Lehnwort aus dem Romani (chorav = ich stehle).

Au rez-d’-chaussée, dans mon HLM
Y’a une espèce de barbouze
Qui surveille les entrées,
Qui tire sur tout c’ qui bouge,
Surtout si c’est bronzé,
Passe ses nuits dans les caves
Avec son Beretta,
Traque les mômes qui chouravent
Le pinard aux bourgeois.

(Renaud, Dans mon HLM, 1980)

choure f [ʃuʁ]

Diebstahl.

Ils ont beau truffer chaque m² de caméras et renvoyer les plus goinfres régulièrement, rien n’y fait la choure est devenue systématique.

(Johnito @ fdesouche.com, 02/2011)

chourer v [ʃuʁe]

Stehlen, Lehnwort aus dem Romani (chor = stehlen).

Cela démontre, si besoin était, que télécharger illégalement un album et chourer le disque à la FNAC, ce n’est pas pareil. Chourer un disque, c’est beaucoup moins dangereux.

Das beweist, sollte es noch notwendig sein, dass ein Album illegal zu laden und die Platte im Laden zu klauen nicht dasselbe ist. Eine Platte zu klauen istbei Weitem nicht so gefährlich.

(poilagratter @ numerama.com, 10/2010)

chourin m [ʃuʁɛ̃] (cités)

Messer. Lehnwort aus dem Romani.

Voilà donc une lame ! Qui est-ce qui en veut ? Avec un chourin comme ça, j’aborderais un taureau furieux !

(Eugène Sue, Les mystères de Paris, 1843)

chourineur m [ʃuʁinœʁ]

Messerstecher.

— Y z’étaient ni pseudos ni maçons, soupire la Protubérance, mais chourineurs, ça oui.

(San-Antonio, Concerto pour porte-jaretelles, 1976)

chourrer v [ʃuʁe]

Stehlen, Lehnwort aus dem Romani (chor = stehlen).

En plus, je me suis fait chourrer une pinte de Guinness pendant le concert. C’est inadmissible, ça ne se fait pas ici.

Dazu hat man mir ein Pint Guinness während des Konzert gemopst. Das ist unerträglich, sowas macht man hier nicht.

(roro @ blogspot.com, 05/2010)

chouya m [ʃuja]

Wenig, eine sehr kleine Menge. Aus dem Arabischen (شوية šuwayya, Kleinigkeit).

Un p’tit chouya en retard, je souhaite bien évidemment un prompt rétablissement à ton amie, et espère sincèrement que tout s’est passé du mieux qu’on puisse l’espérer !

(Christelle @ canalblog.com, 04/2010)

chtar m [ʃtaʁ]

1. Faustschlag;

Son Iphone s’est pris un chtar de la mort sur la face pile. C’est arrivé hier soir. Un fâcheux l’a bousculée à la station Réaumur.

(traveller-famine-party.net, 10/2010)

2. Knast, Gefängnis (aus dem Romani).

Alors oui, on s’y suicide ; et ce ne sont pas les gros durs à leur nième passage au « chtar » qui vont passer à l’acte, ce sont les primodélinquants les plus fragiles, ceux dont même les matons se demandent ce qu’ils font là.

(al @ libeorleans.fr, 08/2009)

chtarbé Adj [ʃtaʁbe]

Verrückt, bekloppt.

Ça voudrait dire, dramatiquement, qu’il serait un peu chtarbé. Et ça, c’est très grave.

(Jean-François Probst @ Arrêt sur image, 02/2008)

chtouille m [ʃtuj]

Syphilis, Geschlechtskrankheit.

Avant, au moins, avec la chtouille, on avait du plaisir avant de la choper, tandis qu’avec cette grippe du cochon, même pas un petit bonheur ! Là, on tremble seulement et on écoute Wagner.

(Y. Savidan @ yann-savidan.com, 09/2009)

cibiche f [sibiʃ]

Zigarette.

Je me suis assise, confortablement, et adossée au mur. Je vais griller ma dernière cibiche, et j’ai bien l’intention de la savourer, celle là. J’arrête de fumer, c’est dit.

(Pénélope Timiste @ over-blog.com, 07/2006)

ciboulot m [sibulo]

Birne, Kopf.

J’ai dû lire Germinal trop jeune, ça m’a fourré de vilaines idées de lutte syndicale dans le ciboulot.

Ich muß wohl zu jung Germinal gelesen haben, das hat mir lauter blöde Ideen von Gewerkschaftskampf in die Birne gestopft.

(Une blonde dans la ville @ hautetfort.com, 05/2010)

cigare m [sigaʁ]

Schädel, Birne.

Cette histoire, je la connais. Ils sont tous pareils... Ils ne veulent pas tuer, mais quand on leur crie « Coucou, qui est là ! », ils vous ouvrent le cigare à coup de tisonnier.

(San-Antonio, Du poulet au menu, 1958)

cigler v [sigle]

Bezahlen.

Je cherche de la fraîche pour cigler mon breuvage mais il a un geste d’agacement et dit :
— Laissez !

Ich suche nach Zaster um mein Getränk zu bezahlen aber er hat eine genervte Geste und sagt:
— Lassen sie!

(San-Antonio, Princesse Patte-en-l’air, 1990)

cigogner v [sigoɲe]

Zerschlagen.

J’voudrais pas lui cigogner le machin en l’embourbant.

(Voltchitza @ doctissimo.fr, 11/2009)

cinglé Adj [sɛ̃gle]

Verrückt.

Faut la faire psychanalyser
Chez un docteur pour la débarrasser
De ses complexes à tout casser
Sinon elle deviendra cinglée...

(Boris Vian, Bourrée de complexes)

cinoche m [sinɔʃ]

Kino (von cinéma).

Au cinoche de Créteil
Y jouaient que des pornos,
Moi ça m’disait trop rien
J’ les avais déjà vus.

(Renaud, C’est mon dernier bal, 1979)

cirage (dans le ~) Adv [dɑ̃ lə siʁaʒ]

Ohnmächtig sein.

— C’est rudement rageant de se faire expédier dans le grand cirage, sous les yeux d’une jolie fille à laquelle on voudrait raconter des tas de bobards.

(San-Antonio, Réglez lui son compte, 1949)

cirer (en avoir rien à ~) v [ɑ̃ navwaʁ ʁiɛ̃ na siʁe]

Gleichgültig sein.

La bourse, j’en ai rien à cirer.

Auf die Börse gebe ich einen feuchten Scheißdreck.

(Édith Cresson, 1991)

citron m [sitʁɔ̃]

Kopf.

Tout ça, c’est de la théorie, bougonne Bérurier, y a des moments où les contes de ma Mère l’Oie te montent au citron.

(San-Antonio, Le fil à couper le beurre, 1955)

claboter v [klabote]

Abnippeln, sterben.

Eh bien notre dette à nous, va se monter à plutôt deux milliards qu’à un seul. Histoire de commencer à susurrer qu’il va falloir soit dézinguer tous les retraités qui ne foutent rien et nous coûtent un max, soit leur supprimer leurs somptueux émoluments, histoire de les faire claboter en douceur, ce qui nous soulagera de cet intolérable poids social qui pèse sur les frêles épaules de nos valeureuses jeunes générations.

(Maurice Caron @ blogspirit.com, 11/2005)

clakos m [klakos]

Camembert. Auch clacos geschrieben.

Je propose un départ à la fraîche le matin, vers 9h depuis Gare de Lyon, pour un circuit à définir d’un vingtaine de bornes, histoire de pouvoir en profiter aussi bien en marchant qu’en se posant autour d’un petit picnic, le temps de faire au moins sa fête à un clacos et une bouteille de rouge.

(barou @ voyageforum.com, 07/2011)

clamser v [klamse]

Abnibbeln, Sterben.

Deux Norvégiens butent un Congolais pour le plaisir de le voir clamser et les médias norvégiens insultent le Congo...

Zwei Norweger murksen einen Kongolesen ab, für den Spaß ihnen abnibbeln zu lernen und die norwegische Presse beschimpft den Kongo...

(Alex Engwete @ afrikblog.com, 02/2010)

claoui pl [klawi]

Siehe glaoui.

Je me décide donc, profitant d’un coin particulièrement obscur pour passer par-dessus la haie. Je me fous les pognes en sang et des trucs piquants me meurtrissent les claouis.

(San-Antonio, J’ai bien l’honneur de vous buter, 1955)

clape f [klap]

Fresse, Mund.

Elle sort un paquet de Gauloises de son pantalon, s’en visse une dans la clape et va l’allumer dans sa cuistance attenante.

(San-Antonio, Valsez, poufiasses, 1989)

claper v [klape]

Mampfen, Essen.

En clapant énergiquement, je continue mon opération de gamberge.

Während ich energisch mampfe fahre ich mit meiner Grübelei fort.

(San-Antonio, Princesse Patte-en-l’air, 1990)

clapier m [klapje]

Haus, Heim.

Nous sommes assis face à face dans un bus poussif. Autour de nous, c’est plein d’une population laborieuse qui regagne son clapier lisant les nouvelles qui ne la concernent pas avec des mines de clergyman triste.

(San-Antonio, Sérénade pour une souris défunte, 1954)

clapoir m [klapwaʁ]

Fresse, Mund.

Maître Corbeau sur un chêne mastard
Tenait un from’ton dans le clapoir.

(Pierre Perret, Le corbeau et le renard, 1995)

claque m [klak]

Puff, Bordell.

Vous me rappelez quand j’allais au claque du chef-lieu avec mes copains.

Sie erinnern mich an die Zeit, als ich mit meinen Kumpels in den Puff der Kreisstadt ging.

(San-Antonio, Emballage cadeau, 1972)

claqué Adj [klake]

Müde, erschöpft.

Ceci dit cela m’arrange car je suis claqué et je serai content de dormir demain.

(Magnus Imperator @ les-aventuriers-woluwe, 01/2010)

claquer v [klake]

1. Sterben.

Merde, y’a le vieux qui claque !

Scheiße, der Alte ist am Abnippeln!

(Toinet dans San-Antonio, le film, 2004)

2. (über Geld) verprassen, verschwenden.

Bercy claque trois milliards pour une informatique foireuse.

(Le Canard Enchaîné, N° 4604, 21/01/2009)

Être claqué: erschöpft sein.

clean Adj [klin]

Sauber, häufig in Bezug auf Drogenenthaltsamkeit. Aus dem Englischen.

Aujourd’hui, je rentre dans ma chambre, génial, contrairement à l’habitude, mon bureau est tout clean. Je baisse les yeux et vois que tout est en vrac par terre... Ma mère a fait intrusion dans ma chambre et a trouvé que le moyen le plus sûr pour que je range était de tout jeter sur le tapis.

(Era @ VDM, 03/2008)

clébard m [klebaʁ]

Hund, Köter.

Je renifle l’aventure comme un clébard affamé renifle une côtelette faisandée.

(San-Antonio, Laissez tomber la fille, 1950)

Un gosse c’est comme un clébard, ça doit s’éduquer. Une fessée est je pense un moyen efficace pour arriver à éduquer.

(TchorT @ forumdesados.net, 04/2010)

clebs m [klɛbs]

Hund. Aus dem algerischen Arabisch (كَلْب kelb, Hund).

Ben oui, ben je me retrouve avec un clebs complètement fou. Après le cochon d’Inde ayant un penchant pour le rock’n roll j’ai un clébard complétement barré !

(valideuse-en-serie @ over-blog.com, 09/2009)

clille m [klij]

Kunde.

— Non, fais-je en soufflant l’allumette, ça c’est le baratin pour les clilles.

— Nein, sage ich und puste das Streichholz aus, das war das Gedöns für die Kunden.

(San-Antonio, La fin des haricots, 1961)

clochard m [klɔʃaʁ]

Penner.

Cette information est bien réelle. Les clochards devraient être tous criminels. Pourquoi ? Car la société les ignore et elle s’en fout carrément. Normal qu’ils aient des névroses et qu’ils se raccrochent à des paradis artificiels.

(Rollon @ jepolitique.com, 09/2011)

clodo m [klodo]

Obdachloser, Penner (Verformung von clochard).

— Tu vas encore traîner un peu, tu feras encore des p’tites saloperies, comme ça, pour la gamelle. Puis tu glisseras doucement vers la côte des Palmes. Tu finiras clodo à Abidjan et tu te feras descendre un jour en piquant un porte-monnaie ou un litre de rouge. Je te filerais bien mon poing dans la gueule, mais t’irais encore te prendre au sérieux.

— Du wirst noch ein bißchen rumhängen, du wirst noch einige Sauereien machen, so, um zu Essen. Dann gleitest du langsam zur Palmenküste. Du endest dann als Penner in Abidjan und wirst eines Tages dabei abgeknallt, wie du eine Geldbörse oder ein Liter Rotwein klaust. Ich würde dir ja gerne eins in die Fresse hauen, aber da würdest du nur wichtig fühlen.

(Marcel Jullian, Michel Audiard, Henri Verneuil, 100.000 dollars au soleil, 1963)

clope f [klɔp]

Zigarette. Der Begriff war bis in die sechziger Jahre männlich (le clope) wird aber heutzutage fast nur noch weiblich genutzt (la clope).

Aujourd’hui, je mets la nuisette sexy de ma copine pour faire le con et vais fumer une clope sur son balcon. Je la fais rire en me trémoussant devant sa fenêtre jusqu’à entendre un «BONJOUR ! » Son voisin du dessus, légionnaire, tout sourire et ravi du spectacle...

(VDM, 06/2008)

une clope
Une clope, envie de fumer ! P’tin („eine Kippe, ich will rauchen! Scheiße“),
Graffiti im Parc de Choisy, Paris (April 2010)

cloper v [klɔpe]

Zigarette rauchen.

Mais en vrai la dernière fois que j’ai essayé de cloper en 2008 je suis devenue verte, j’ai eu envie de vomir et j’ai eu des sueurs froides.

(Mahie @ wordpress.com, 02/2011)

cloque (en ~) Redewendung [ɑ̃ klok]

Schwanger.

Faut bien dire c’qu’y est
Moi aussi j’débloque
Depuis qu’elle est
En cloque.

(Renaud, En cloque, 1983)

cloquer v [kloke]

Geben.

Rappelez-vous que je suis un drôle de futé. La preuve en est que malgré que tout soit complet dans le train de Rome, j’arrive à me faire cloquer une couchette.

(San-Antonio, Réglez lui son compte, 1949)

clou m [klu]

Fahrrad.

Si un voyageur à pied doit prendre soin, à mon sens, de s’équiper d’un podomètre, le cycliste amoureux des grands espaces ne doit pas omettre d’orner son clou d’un compteur kilométrique.

Wenn ein Fußgägnger, meiner Meinung nach, sich einen Schrittzähler zulegen sollte, so sollte der die Weite liebende Radler nicht unterlassen, seinen Drahtesel mit einen Tacho zu verzieren.

(À vélo au bout du monde @ liberation.fr, 04/2011)

cmb Abk [se.ɛm.be]

Abkürzung der Redewendung comme ma bite (wie mein Schwanz). Wird meistens nach der Bemerkung, etwas wäre besonders groß, hart oder lang, verwendet.

RelaX : Lilly, tu peux pas faire de cmb
Lilly : pourquoi?
RelaX : parce que t’es une fille
RelaX : c’est ridicule
Lilly : ctb
Lilly : au moins là tu peux pas dire le contraire ^^

(bashFR.org)

coco f [koko]

Kokain.

Ma copine, dont je suis fou amoureux, a été grande consommatrice de coco surtout, mais aussi de thaï, de méta- et d’amphètes, etc., avec son ex pendant pratiquement une année.

(utopias2 @ aufeminin.com, 04/2008)

cocotter v [kokote]

Stinken, miefen. Zumeist auf Grund einer Überdosierung von Parfum.

Il vaut mieux parfois sentir le bouc, plutôt que de cocotter comme certains qui ne voient pas ta beauté et qui te poussent à la tristesse.

Es ist gelegentlich wie ein Ziegenbock zu riechen als nach Parfum zu miefen, wie manch einer, der deine Schönheit nicht sieht und dich traurig machen.

(sceniquentite @ live.com, 12/2005)

cogne m [kɔɲ]

Bulle, Polizist.

A pied, à cheval, en voiture
Les gendarmes mal inspirés
Vinrent pour tenter l’aventure
D’interrompre l’échauffourée
Or, sous tous les cieux sans vergogne
C’est un usag’ bien établi
Dès qu’il s’agit d’rosser les cognes
Tout le monde se réconcilie.

(Georges Brassens, Hécatombe, 1953)

coiffe f [kwaf]

Schädel, Birne.

Il y a encore, dans la vieille Europe, des pays qui ne vivent pas mais qui fonctionnent bien, et j’ai l’impression que l’Autriche est de ceux-là. Pas besoin d’avoir son bac à choléra, comme dit Béru, pour comprendre qu’ici les pendules sont à l’heure, les commerçants honnêtes et les routes regoudronnées chaque année. M’est avis que si l’archiduc Roro s’est praliné la coiffe, c’est parce qu’il se faisait tartir comme un pou sur une tronche de chauve.

(San-Antonio, Baisse la pression, tu mes les gonfles !, 1988)

coller v [kole]

1. Nachsitzen (in der Schule);

Je me suis fait coller une heure pour avoir bavardé en cours... Choquant non ?

(Sidious 94 @ france2.fr, 10/2006)

2. nicht wissen (bei einer Prüfung).

colon m [kolɔ̃]

Oberst (Verformung von colonel).

Moi, mon colon, cell’ que j’ préfère,
C’est la guerr’ de quatorz’-dix-huit !

(Georges Brassens, La guerre de 14-18, 1961)

coloquinte f [kolokɛ̃t]

Schädel, Birne.

Mais ce vieux B est un vieux bricoleur ! Croyez-moi : dans sa coloquinte, il y a mille et une idée.

(houmidi59 @ oudjacity.net, 10/2008)

coltard (être dans le ~) m [ɛtʁ dɑ̃ lə koltaʁ]

Im aufrechten Halbschlaf sein, sehr müde sein. Ursprünglich besoffen sein (être dans le coaltar), als Anspielung auf die Ähnlichkeit von billigem Rotwein und Steinkohlenteer (coaltar).

Aujourd’hui, au réveil, dans le coltard comme d’habitude, j’ai pissé dans ma poubelle... pourtant la ressemblance avec mes toilettes n’est pas frappante.

Heute morgen, wie immer im Halbschlaf, habe ich in meinen Mülleimer gepinkelt... dabei ist die Ähnlichkeit mit meiner Toilette nicht gerade auffällig.

(VDM, 03/2008)

coltiner v [koltine]

Tragen.

Mais le plus saugrenu du personnage est constitué par un monceau de bijoux qu’elle semble coltiner avec peine.

(San-Antonio, La vieille qui marchait dans la mer, 1988)

comater v [komate]

Vor sich hindämmern.

Eh les gars, arrêtez de comater !

(Stafford CLC 2007 @ skyrock.com, 08/2007)

commak Adv [komak]

So (= comme ça).

Il n’y a qu’à moi que ça arrive, des trucs commak, vous ne l’ignorez pas !

Solche Dinger, so was passiert nur mir, dass wisst ihr ja!

(San-Antonio, Berceuse pour Bérurier, 1960)

con m [kɔ̃]

1. Muschi, Fotze, Scheide; 2. Idiot, Dummkopf, Blödmann.

Le temps ne fait rien à l’affaire, quand on est con, on est con !

Die Zeit tut hier nichts dazu, wenn man blöd ist ist man blöd.

(Georges Brassens, Le temps ne fait rien à l’affaire, 1961)

Casse-toi, pauv’con !

Verpiss’ dich, du Armleuchter!

(Nicolas Sarkozy, 02/2008).

condé m [kɔ̃de]

Polizist, Bulle.

Avant on avait un flic ou deux raidis par ans, au cours d’une fusillade, après un braquage. Le coté viril de la fonction. Rien de terrible. Maintenant le condé lambda vit avec la perspective constante de se faire lyncher par une bande d’enragés, et de manière chaque fois un peu plus gore.

(Vladimir Vladimirovich @ ilikeyourstyle.net, 09/2010)

connard m [kɔnaʁ]

Idiot, Arschloch.

La société est bien foutue. Ils mettent des uniformes aux connards pour qu’on puisse les reconnaître.

(Albert Dupontel)

Diez’: de toute manière, dans ma classe, la moitié c’est des connards et des gays, l’autre c’est des grosses cochonnes.
Gin: et tu te situerais plutôt dans quelle catégorie ?

(DTC, 12/2009)

connasse f [kɔnas]

Zicke.

Aujourd’hui, je retrouve sur mon capot une rose accompagnée d’un numéro de téléphone. Émoustillée, je compose le numéro. « C’est vous la connasse qui s’est garée en double file devant ma voiture ? Bougez pas, j’arrive, j’ai deux mots à vous dire. »

(VDM, 10/2009)

deux connasses
Salut ! À côté de moi (il) y a deux connasses qui écrivent des bêtises sur moi („Hallo! Neben mir stehen zwei Zicken, die Blödsinn über mich schreiben“),
La cabanette, Luc-en-Diois (August 2010)

conne f [kɔn]

Blöde Kuh.

Lagarde et l’affaire Proglio : « Ils m’ont prise pour une conne ! »

(Le Canard Enchaîné, N° 4657, 27/01/2010)

connerie f [kɔnəʁi]

Blödsinn, etwas unwichtiges.

— Si la connerie n’est pas remboursée par les assurances sociales, vous finirez sur la paille.

(François Boyer, Un singe en hiver, 1962)

contredanse f [kɔ̃tʁədɑ̃s]

Strafzettel.

— Il est d’une honnêteté monstrueuse, un vrai pervers, enfin je veux dire. Il n’a jamais eu une contredanse quoi...

— Er ist mordsmößig ehrlich, richtig pervers, na ja, ich meine ja. Er hat nie ein einziges Knöllchen kassiert...

(Michel Audiard, Mélodie en sous-sol, 1963)

cool Adj [kul]

Geil, dufte, toll.

Une journée super cool, pleine de sensations fortes...

(Océane @ oceaneblog.com, 07/2010)

copeaux pl [kopo]

Angst.

Ça c’est parce qu’on a les copeaux, que ça fait ça... genre adrénaline...

Das fühlt sich wegen dem Bammel so an... Adrenalin und so...

(tocsif @ cyclogalet.net, 08/2011)

corgnolon m [koʁɲolɔ̃]

Magen, Bauch.

Gnafron : ami de Guignol se ramone le corgnolon au Beaujolais, cordonnier, il répare les grolles.

(FMarmotte5 @ over-blog.com, 01/2009)

cornet m [kɔʁnɛ]

Ohr.

Je me penche sur lui et je lui souffle dans l’oreille avec une telle compression que je pourrais déboucher ainsi l’évier le plus récalcitrant. Le Gros sursaute et s’enfouit l’auriculaire dans le cornet.

(San-Antonio, L’histoire de France vue par San-Antonio, 1964)

corniaud m [kɔʁnjo]

Armleuchter.

Bourvil joue le corniaud, le naïf émouvant qui effectue innocemment un extraordinaire périple et joue le joli cœur, tandis que De Funès incarne la mauvaise foi « montée sur ressort » cherchant à exploiter son acolyte, un chef de bande colérique et fébrile qui voit tous ses plans malhonnêtes s’effondrer au fur et à mesure du chemin.

(wikipedia, Le Corniaud, 05/2011)

costard m [kɔstaʁ]

Anzug.

Faut pas trop traîner dans les bars à moins d’être fringué en costard.

(Renaud, Laisse béton, 1977)

coucougnettes f [kukuɲɛt]

Eier (Hoden).

En fait, faut juste retenir un truc très important : l’endroit le plus sensible chez les garçons, c’est les coucougnettes !
Donc faut arriver à viser cet endroit, et normalement ton attaquant il est tout kapoutte.

Eigentlich muß man nur eine sehr wichtige Sache wissen: Die empfindlichste Stelle bei Jungs sind die Eier!
Also muß man es hinkriegen diese Stelle zu treffen und normalerweise ist dein Angreifer kaputt.

(Sonia @ hautetfort.com, 04/2010)

couille f [kuj]

Eier (Hoden). Siehe auch avoir des couilles au cul, avoir les couilles, casse-couilles, couille-molle, s’en battre les couilles, partir en couille

Le curé de Camaret a les couilles qui pendent (bis)
Et quand il s’assoit dessus
Elles lui rentrent dans le cul
Il bande (ter)

(Les filles de Camaret / Volkslied)

couille (partir en ~) Redewendung [paʁtiʁɑ̃ kuj]

Den Bach hinuntergehen, sich verschlechtern.

Là, ça va vraiment partir en couille : 5 caisses brûlées dans ma « ville » cette nuit, 15 en tout sur la périph de Montpellier... ça va mal se finir.

Jetzt wird es echt krass werden: 5 verbrannte Karren in meiner Stadt heute Nacht, 15 insgesamt in der ganzen Umgebung von Montpellier... das wird nicht gut enden.

(Guess 34 @ 321auto.com, 11/2005)

couille-molle f [kuj mɔl]

Angsthase, Weichei.

Non, Bayrou n’est ni un traître, ni une « couille molle centriste ».

(Herlock @ fr.soc.politique, 05/2006)

couilles (avoir des ~ au cul) Redewendung [a.vwaʁ dɛ ku.jo ky]

Mutig, männlich, stark sein.

C’est vrai que t’es un mec qui n’a pas de couilles au cul... alors arrête de provoquer... tu te ramasses une gifle ici, idiot...

(soc.culture.belgium, 11/2008)

couilles (avoir les ~) Redewendung [a.vwaʁ lɛ kuj]

Den Mut zu etwas haben.

Si on te sucrait ta retraite à 2 doigts de la retraite, je suppose que tu réagirais pareil, reste à voir si tu aurais les couilles de le faire !

(Milou @ fr.soc.politique, 06/2004)

couilles (s’en battre les ~) Redewendung [sɑ̃ batʁ le kuj]

Keinen Scheiß auf etwas geben, Ausdrück der Gleichgültigkeit.

Certes il y avait déjà des casses-couilles mais ça c’est comme partout hein... Tu rentres dans un troquet y’en a toujours un pour montrer qu’il existe ! Enfin je vous fais pas l’historique pour la nostalgie ou me justifier j’m’en bat les couilles...

(MrJulesjazz @ guitarejazzmanouche.com, 11/2012)

couilles (se bouffer les ~) Redewendung [sə̃ bufe le kuj]

Sich in den Bauch beißen können, Ausdruck des tiefen Bedauerns.

Prend ton matos sinon tu vas te bouffer les couilles si il y a du vent :) Je partirais sur un flotteur + 2 voiles dans le genre 5.5 et 7.0.

(Tibi @ fr.rec.sport.voile.planche, 06/2003)

couillon m [kujɔ̃]

Idiot, Depp.

Il vaut mieux voter pour un couillon comme moi que pour quelqu’un qui vous prend pour un couillon !

Es ist immer noch besser für so einen Armleuchter wie mich zu stimmen, als für einen der euch für Armleuchter hält!

(Coluche)

couillonner v [kujone]

Betrügen.

On ne va pas se faire couillonner deux fois.

(François Chérèque, 05/2010)

couillu Adj [kujy]

Männlich („mit Eiern“).

En ce moment tout les « partis de gouvernement » pratiquent la même politique de fond et ne modifient que la forme alors que c’est le contraire qu’il faudrait faire, pour cela il faudrait des politiques couillus et nous n’avons que des trouillards, où que ce soit en Europe.

(pierguiard @ ubuntu-fr.org, 05/2010)

couler un bronze v [kule œ̃ bʁɔ̃z]

Stuhlgang haben („Eine Bronze gießen“).

J’imagine bien le service « innovation » chez Free : « Hey les gars ce matin, j’étais en train de couler un bronze dans mes toilettes, et je me suis dis : pourquoi pas mettre à dispo une API pour piloter la Box HD ? »

(Anonyme @ universfreebox.com, 04/2010)

coup (tirer un ~) m [tiʁe œ̃ ku]

Eine Nummer schieben, pudern, pimpern.

J’ai dormi et ce matin j’ai été réveillé par des coups. Ça faisait tac tac tac tac et puis tactactactac et puis tacatacatacatacatacatac et puis plus rien. Ça a duré quelques minutes. Mes voisins tiraient un coup à 8h du matin un lundi avant d’aller au travail, ce qui démontre un bel enthousiasme, et aussi une certaine capacité à baiser à peine réveillé, avec la vessie pleine et la bouche pâteuse.

(Le tampographe Sardon @ blogspot.com, 09/2010)

coupe-tif m [kup-tif]

Friseur.

Coupe-tif pas cher du tout !

Ein ganz günstiger Friseur!

(Vincent @ blogspot.com, 04/2006)

courser v [kuʁse]

Verfolgen, jagen.

Le parkour est aussi appelé l’art du déplacement. Le parkour est très utile pour s’échapper des mauvaises situations (par exemple : se faire courser par un chien).

Parkour wird auch die Kunst der Bewegung genannt. Parkour ist sehr nützlich, um aus unangenehmen Lagen zu entkommen (zum Beispiel, wenn man von einem Hund gejagt wird).

(ausujet.com, 02/2001)

cousue f [kuzy]

Zigarette.

Je sors du RER à Port Royal, avec une envie irrépressible de fumer une cigarette. Mes poches sont désespérément vides de toute trace de tabac. — « Mon royaume pour une cousue, une cibiche... »

Ich steige bei Port Royal aus der S-Bahn und fühle ein unbezwingliches Bedürfnis eine Zigarette zu rauchen. Meine Taschen sind heillos frei von jeder Spur von Tabak. — „Mein Königreich für ein Lungentorpedo, für eine Kippe...“

(Le controleur @ canalblog.com, 03/2011)

couvrante f [kuvʁɑ̃t]

Decke.

Résultat des courses : tout le monde se déteste, chacun essayant de tirer la couvrante vers soi et d’accrocher la lumière des projos.

(haddock @ bide-et-musique.com, 04/2004)

crac-crac m [kʁak-kʁak]

Euphemismus für Sex, Geschlechtsverkehr. Faire crac-crac: ficken.

Classiquement, les hommes font leur cour, demandent en mariage, cherchent à faire crac-crac, et les femmes les regardent faire, font attendre ou se disent que ces gros cochons feraient mieux de prendre du bromure, substance licite qui, comme on le sait, n’est pas prévue pour mettre du fun dans les galipettes. Au contraire même.

Üblicherweise hofieren die Männer, sie machen Heiratsanträge, versuchen zu pimpern und die Frauen beobachten sie dabei, lassen sie warten oder denken sich, dass diese Schweine lieber etwas Brom einnehmen sollten, ein legales Mittel, das wie bekannt nicht dafür gedacht ist, Feuer unter die Decke zu bringen. Im Gegenteil sogar.

(J. Goetelen @ tdg.ch, 09/2010)

cracher v [kʁaʃe]

Ejakulieren.

— Tu sais je n’aime pas jouir seul. Alors vas-y toi aussi et crache ta purée et je cracherai la mienne dans ton joli p’tit cul si accueillant.

(Nirdla @ canalblog.com, 10/2011)

crade Adj [kʁad]

Schmutzig. Variante: crado, crados, cradingue.

Dealer pour survivre, braquer pour survivre.
C’est clair, peu importe les moyens, tout faire pour survivre,
S’investir, être son propre boss,
Même si l’argent est crade, c’est le même négoce.

(Expression direkt, Condamné à réussir)

cramer v [kʁame]

Brennen.

Urreta se fait crâmer son break. Le break du joueur prêté par Benfica à Peñarol a été incendié après la défaite lors du derby face au Nacional.

(machainesport.fr, 05/2011)

cramouille f [kʁamuj]

Fotze.

Elle traverse une période de longue abstinence sexuelle forcée. Alors comme elle sait que tu la kiffes malgré tout ce qu’elle t’a fait endurer, elle veut t’emprunter juste un soir le temps de se soulager la boîte à cramouille, et te rerejeter comme une merde.

Sie erlebt gerade eine lange gezwungene sexuelle Abstinenzperiode. Und da sie weiß, daß du auf sie stehst, trotz allem, was sie dir angetan hat, will sie dich für einen Abend ausleihen, um ihre Fotze zu erleichtern, und dann wird sie dich wie ein Scheißdreck wegwerfen.

(elbarto_33 @ jeuxvideo.com, 08/2009)

cran (être à ~) m [ɛtʁ a kʁɑ̃]

Verärgert sein, angespannt sein.

En ce moment rien ne va, tout m’énerve. Je suis à cran, je m’agace pour un rien. Je n’ai aucune patience.

(La fée tatouée @ wordpress.com, 10/2011)

crapahuter v [kʁapa.yte]

Durch unwegsames Gelände gehen, mühsam vorankommen.

L’accessibilité est réservée aux personnes physiquement aptes à crapahuter en milieu montagnard, chose plutôt hostile vu qu’ici rien n’est plat !

(cevennes @ unblog.fr, 09/2010)

crapaud m [kʁapo]

Geldbörse, Portemonnaie.

Je tire cinq lacsés de mon crapaud et, pudiquement, je les dépose sur la table.

Ich hole fünf Zehner aus meiner Brieftasche und lege sie verschämt auf den Tisch.

(San-Antonio, La tombola des voyous, 1957)

craque m [kʁak]

Lüge.

La TVA, tu ne fais que la collecter, arrête de raconter des craques. La TVA, c’est le consommateur final — moi entre-autres — qui la paye. Pas les entreprises.

Die Mehrwertsteuer sammelst du nur ein, erzähl keinen Scheiß. Die Mehrwertsteuer bezahlt der Endverbraucher, ich unter anderen. Nicht die Unternehmen.

(Tonton Georges @ intox2007.info, 04/2010)

crasseux m [kʁasø]

Kamm.

Mais où j’ai foutu mon peigne ? Ou alors on me l’a piqué, qui a pu chouraver mon crasseux ?

(fogerty john @ cybermarcheur.com, 12/2010)

cravacher v [kʁavaʃe]

1. Sich beeilen; 2. Malochen, sich anstrengen, schuften.

Toulon va devoir cravacher pour décrocher sa qualification pour les barrages.

(Dav-D @ blog-rct.com, 03/2011)

cravate de notaire f [kʁavat də notɛʁ]

Masturbation, bei der das Glied zwischen den Brüsten der Partnerin geklemmt wird („Notarenkrawatte“).

Malgré certains clichés véhiculés à tort, la cravate de notaire (toujours chic, jamais vulgaire), n’est pas une pratique réservée aux poitrines voluptueuses. Tous les seins, même les plus modestes, sont à la hauteur de cette délicieuse caresse. Le souci, c’est de parvenir à optimiser le processus malgré un 85 B.

(Gaelle-Marie Zimmermann @ zonezerogene.com, 04/2010)

cravater v [kʁavate]

Erwischen, fassen, verhaften.

Une ordure qui cravatait Pierrot par derrière, et il devait serrer à fond, car Pierrot ne pouvait plus diriger.

(Simonin, Touchez pas au grisbi, 1953)

cravetouze f [kʁavətuz]

Krawatte.

Plus précisément et habillement parlant — en considérant qu’habillement soit un adverbe —, je porte des godillots blancs, un bénouze tout aussi blanc, mais encore une veste de costume, une cravetouze et une chemise blanches de blanches !

(Antoine Chimel, Le zig au flingue d’or, 10/2010)

crèche f [kʁɛʃ]

Wohnung, Absteige.

Sa crèche se trouve rue Laborde.

Ihre Bude befindet sich rue Laborde.

(San-Antonio, Laissez tomber la fille, 1950)

crècher v [kʁɛʃe]

Wohnen.

— Je crèche à l’hôtel Belcrampe, rue de l’Amiral René-Cossu.

(San-Antonio, J’ai essayé, on peut, 1973)

crève f [kʁɛv]

Schnupfen, Erkältung.

Donc, toutes les sorties vélo, je serais en zone rouge et avec la crève que j’ai choppé je vais souffrir toute la semaine.

So, für alle Fahrradtouren, ich werde im roten Bereich sein und mit der Rüsselseuche, die ich mir eingefangen habe, werde ich die ganze Woche leiden.

(stephtri @ wordpress.com, 08/2011)

crever v [kʁəve]

Den Löffel abgeben, sterben.

Mourir ? Plutôt crever !

Sterben? Lieber verrecken!

(Film de Stéphane Mercurio sur Siné, 2010)

crevure f [kʁəvyʁ]

Arschloch, Scheißtyp.

Les seuls avenirs envisageables pour un bébé français d’aujourd’hui, je veux dire si l’on tient à ce qu’il ne manque jamais de rien, c’est d’en faire une crevure politique qui trahira jusqu’à sa propre mère ou à défaut, un autre criminel spécialisé dans un business qui rapporte aussi gros que le premier ; la drogue par exemple, ça me paraît pas mal.

(poliblog @ canalblog.com, 07/2010)

criave v [kʁiav] (cités)

Essen. Lehnwort aus dem Romani (kha — essen).

Un jour il m’a retourné. Il avait réussi à sortir un putain de sauciflard et de la rosette de Lyon, le tout au rayon à la découpe. Trop fort.. Bien sûr il a tout criave, en me disant qu’il en avait rien à foutre du Coran et que faire le Ramdam ça le faisait chier...

(cp5crew @ wordpress.com, 06/2009)

crins pl [kʁɛ̃]

Haare.

Les gars qui se frottent les crins à l’eau oxygénée ne correspondent pas à mon temperament, et je les passé au presse-purée lorsqu’ils donnent l’ordre de me lessiver, tu saisis ?

(San-Antonio, Les souris ont la peau tendre, 1951)

crobard m [kʁobaʁ]

Zeichnung, Skizze.

Je suis parti respirer l’iode normand pendant cinq jours, ses alcools brûlants et ses crêpes en plastique n’ont plus de secret pour mon organisme vivifié. Avant de prendre mon bâton de pélerin, j’avais juste eu le temps de réaliser deux minables petits crobards pour un texte de Godin qui paraîtra cette semaine.

Fünf Tage lang war ich die Meeresluft der Normandie atmen, die örtlichen brennenden Schnäpse und Crêpes aus Plastik haben für mein neubelebtes Organismus keine Geheimnisse mehr. Bevor ich mein Pilgerstab wieder in die Hand genommen habe hatte ich gerade nur Zeit zwei kleine Zeichnungen für einen Text von Godin, der diese Woche erscheint, zu machen.

(Philippe Decressac @ canalblog.com, 01/2010)

croc m [kʁo]

Zahn.

Corbeau-le-ballotin sur un arbre paumé,
Planquait entre ses crocs un comac frodogome.

(Le corbeau et le renard, Fables de La Fontaine en argot)

crocs (avoir les ~) v [avwaʁ le kʁo]

Hungrig sein.

Pas une bricole à bouffer ? s’informe Bérurier, j’ai les crocs !

Gibt’s keine Kleinigkeit zu Futtern? Informiert sich Bérurier, ich habe einen Mordshunger!

(San-Antonio, Le fil à couper le beurre, 1955)

croquant m [kʁokɑ̃]

Bauer.

Elle est à toi, cette chanson,
Toi, l’Étranger qui, sans façon,
D’un air malheureux m’as souri
Lorsque les gendarmes m’ont pris.
Toi qui n’as pas applaudi quand
Les croquantes et les croquants,
Tous les gens bien intentionnés,
Riaient de me voir emmener...

(Georges Brassens, Chanson pour l’Auvergnat, 1955)

croque f [kʁok]

Essen, Futter.

Bérurier s’est remis à bouffer, fataliste, vite résigné à tout, le Dodu. La croque l’entraîne dans son torrent calorique. Tant qu’y a de la mange, y a de la vie, pour lui.

(San-Antonio, Concerto pour porte-jaretelles, 1976)

crosse f [kʁos]

Streit.

Commence pas à chercher des crosses, on va jamais y arriver.

(kodok @ soc.culture.french, 07/2004)

crouille m [kʁuj]

Nordafrikaner, Araber. Rassistische Bezeichnung die aus der nordafrikanischen arabischen Anrede خويا (ẖuyā — mein Bruder) stammt.

Tu sais on a trop une sale réputation
On est tous cramés par leur institution
Trop condamnés par leur juridiction
Allez, on vit dans la merde et c’est pas une fiction
Peut-être qu’on s’intègre, moi j’suis né ici comme beaucoup d’crouilles et de nègres.
Mec ça sent l’vinaigre et la rue c’est la pègre.

(LIM, J’ai mal au cœur)

crounir v [kʁuniʁ]

Abmurksen, umbringen.

Si je ne trouve pas une planque, j’vais crounir de froid.

(marc29 @ nanarland.com, 03/2008)

croûter v [kʁute]

Fressen, futtern.

Tant que nous serons riches et que nos patrons auront des emplois à offrir pour faire tourner notre machine à consommer, des pauvres venus d’ailleurs, d’Afrique en particulier, viendront chez nous pour faire croûter leur famille.

Solang wir reich sind und unsere Chefs Stellen anbieten können, um unseren Verbrauch zu erhalten, werden Arme aus anderen Ländern, insbesondere Afrika, zu uns kommen, damit ihre Familien futtern können.

(blogspot.com, 10/2010)

crouter (se ~) v [sə kʁute]

Fallen, stürzen, sich lang machen.

Le 2 avril 2011 est un jour inoubliable à la Nautique, le premier jour où je suis montée sur une planche : Bob (oui je leur donne des noms) et la voile : Allie. Se crouter, rigoler, remonter, avancez, se crouter, se plaindre, remonter, y arriver, être content.

(Alexandra @ skyrock.com, 04/2011)

ctb Abk [se.te.be]

Abkürzung der Redewendung comme ta bite (wie dein Schwanz).

Minux : Je crois qu’une miss est amoureuse de moi...
traf : Oo pourquoi tu crois ça?
Minux : Elle a répondu « CTB » après une phrase où j’ai dit « énorme »
traf : ah ouais, quand même...

(danstonchat.com, 09/2010)

cucul Adj [kyky]

Naiv, lächerlich.

Un peu comme les derniers commentaires, je trouve ça super cucul, kitch... pour moi c’est l’équivalent des kikoolol mais dans le monde des bisounours et c’est complément naze.

(Pif @ stupidbook.fr, 07/2010)

Cela a l’air cucul de le dire, mais réenchanter la politique [...], ça compte.

(Martine Aubry, 09/2011)

cuir m [kɥiʁ]

Lederjacke.

Pour un budget de 150-200€, tu pourras avoir un bon cuir certes mais d’occasion uniquement. Essaie donc les friperies si tu es sur Paris.

(Loth @ spikeseduction.com, 01/2010)

cuistot m [kɥisto]

Koch.

Mais au gril, à l’heure où je les quitte, mes camarades cuistots ont le moral en berne.

(L’Express @ blogspot.com, 02/2011)

cuite f [kɥit]

Besäufnis.

Aujourd’hui, j’ai dû tenir le bureau de vote dans la ville où j’habite. J’ai pris une cuite énorme la veille, je n’ai pas encore dormi, Il n’y a que des vieux qui sont venus voter... Je me suis endormi et j’ai bavé sur le registre.

Heute musste ich ein Wahlbüro in meiner Stadt leiten. Ich habe mir am Vortag so die Kante gegeben, ich habe noch nicht geschlafen, es sind nur Alte wählen gekommen... Ich bin eingeschlafen und habe über das Register gesabbert.

(VDM, 03/2008)

cuiter (se ~) v [sə kɥite]

Sich besaufen.

La sangria (Vin rouge, fruits, épices) : fourbe car sucrée et peu alcoolisée. Contient malgré tout du vin rouge, et comme chacun sait, il ne fait pas bon se cuiter au vin rouge. Six verres plus tard, vous voilà en train de vous ébrouer sur la danse des canards. On vous avait pourtant dit de ne pas sucer les fruits.

(Anaelle @ topito.com, 08/2011)

cul m [ky]

1. Hintern.

Sur le plus beau trône du monde, on n’est jamais assis que sur son cul !

Selbst auf dem schönsten Thron der Welt sitzt man doch nur auf seinem Gesäß!

(Montaigne)

pose ton cul
pose ton cul („leg deinen Arsch ab“),
Graffiti in Yerres (Juli 2009)

2. Sex (un film de cul : ein Sexfilm).
Faux-cul: Heuchler.
On se sort les doigts du cul !: Jetzt geht’s ran an die Arbeit.

cul (gros ~) m [gʁo ky]

Brummi, Lkw.

Lui, la limitation, il fait comme si pas. Derrière son caducée, il s’estime à l’abri des pandores et des accidents. Tu le verrais doubler des cohortes de gros culs, tu fermerais les yeux et te déboucherais les oreilles.

Er verhält sich, als gäbe es keine Begrenzung. Hinter seinem Arztausweis hält er sich für sicher vor den Bullen und den Unfällen. Wenn du sehen könntest, wie er Brummikolonnen überholt, dann würdest Du die Augen schließen und die Ohren öffnen.

(San-Antonio, Concerto pour porte-jaretelles, 1976)

cul (plan ~) m [plɑ̃ ky]

Auf den Geschlechtsverkehr zielende Beziehung.

Aujourd’hui et pour la première fois de ma vie, j’ai demandé à un garçon son numéro de portable. Il m’a proposé un plan cul par texto.

(VDM, 04/2008)

cul terreux m [ky tɛʁø]

Bauer, Landei.

Quand je croise un voleur malchanceux
Poursuivi par un cul-terreux
Je lance la patte et pourquoi le taire
Le cul-terreux se retrouve par terre

(Georges Brassens, La mauvaise réputation, 1952)

culbuter v [kylbyte]

Flachlegen, bumsen.

A chaque fois qu’y culbute une collègue de bureau
Ou qui va s’faire une pute, ce ringard, ce blaireau
Y dit qu’c’est pas tromper que c’est juste pour l’hygiène
Mais qu’si sa femme l’imitait il l’assom’rait à coups de beignes.

(Renaud, Mon beauf’, 1981)

cunni m [kyni]

Cunnilingus.

Le cunni c’est quelque chose que je souhaiterai faire à ma chérie, elle est d’accord donc je voudrai pas rater ce moment à deux, donc je voulais savoir quelles sont choses à faire, à ne pas faire et puis quelsques petits conseils.

Ich würde gerne meiner Süßen eine Cunnilingus machen, sie ist einverstanden und ich wollte diesen Moment der Zweisamkeit nicht vermasseln, also wollte ich wissen, was man machen sollte, was nicht und einige kleine Ratschläge.

(William972 @ comlive.net, 01/2007)

cure-dents m [kyʁ-dɑ̃]

Messer.

On dispose également de finish move dans les attaques corps à corps comme dans KZ3, genre on plante son cure dent de trente centimètres dans la quiche d ’un mort vivant !

(ermite13600 @ xooit.fr, 04/2011)

cureton m [kyʁətɔ̃]

Pfaffe, Pfarrer. Verballhornung von curé.

Anticléricaux fanatiques
Gros mangeurs d’écclésiastiques,
Quand vous vous goinfrerez un plat
De cureton, je vous exhorte,
Camarades, à faire en sorte
Que ce ne soit pas celui-là.

(Georges Brassens, La messe au pendu, 1976)

Ici, y a pas de cureton régulier. C’est un recteur du continent qui vient célébrer la messe le dimanche quand il ne fait pas de gros temps.

(San-Antonio, Si ma tante en avait, 1978)



Russe-français
Russisch-Deutsch
Rusianeg-Brezhoneg
Russian-English
Ρώσικα-Ελληνικά
Russo-italiano
Ruso-español
Rus-român
Orosz-Magyar
Ruso-aragonés
Rusice-Latine
Французско-русский
Немецко-русский
Бретонско-русский
Allemand-français
Argot-français
Блатной жаргон
Soldatensprachführer
Военные разговорники